Dissertations and Theses @ UNI
Award Winner
Recipient of the 1997 Outstanding Master's Thesis Award - First Place.
To go to the Graduate Student Award Recipients collection page, click here.
Availability
Open Access Thesis
Keywords
Mycorrihizas--Identification; Soil fungi--Identification;
Abstract
We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for Glomus mosseae) which included incorporation of the RAPD primer sequence. The presence of these fungi in infected roots can be detected even in the company of competing genomic DNA's by the amplification of a 269 bp (base pair) fragment from Gigaspora margarita, and a 381 bp fragment from Glomus mosseae. This approach can be used to study the distribution and variation of AM fungi in infected roots.
Year of Submission
1995
Year of Award
1997 Award
Degree Name
Master of Arts
Department
Department of Biology
First Advisor
James E. Jurgenson, Chair, Thesis Committee
Date Original
2018
Object Description
1 PDF file (ix, 69 pages)
Copyright
©1995 Jason Daniel Abbas
Language
en
File Format
application/pdf
Recommended Citation
Abbas, Jason Daniel, "The development of SCARS for identification of AM fungi" (1995). Dissertations and Theses @ UNI. 664.
https://scholarworks.uni.edu/etd/664
Comments
If you are the rightful copyright holder of this thesis and wish to have it removed from the Open Access Collection, please submit an email request to [email protected]. Include your name and clearly identify the thesis by full title and author as shown on the work.