Dissertations and Theses @ UNI

Award Winner

Recipient of the 1997 Outstanding Master's Thesis Award - First Place.

To go to the Graduate Student Award Recipients collection page, click here.

Availability

Open Access Thesis

Keywords

Mycorrihizas--Identification; Soil fungi--Identification;

Abstract

We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for Glomus mosseae) which included incorporation of the RAPD primer sequence. The presence of these fungi in infected roots can be detected even in the company of competing genomic DNA's by the amplification of a 269 bp (base pair) fragment from Gigaspora margarita, and a 381 bp fragment from Glomus mosseae. This approach can be used to study the distribution and variation of AM fungi in infected roots.

Year of Submission

1995

Year of Award

1997 Award

Degree Name

Master of Arts

Department

Department of Biology

First Advisor

James E. Jurgenson, Chair, Thesis Committee

Comments

If you are the rightful copyright holder of this thesis and wish to have it removed from the Open Access Collection, please submit an email request to [email protected]. Include your name and clearly identify the thesis by full title and author as shown on the work.

Date Original

2018

Object Description

1 PDF file (ix, 69 pages)

Language

en

File Format

application/pdf

Included in

Genetics Commons

Share

COinS